View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_high_21 (Length: 274)
Name: NF14337_high_21
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_high_21 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 33 - 274
Target Start/End: Complemental strand, 45690434 - 45690193
Alignment:
| Q |
33 |
gtaatactattaaatggtaagggaaacaaaatgaaagtataaaggaggatgatagttgagagtgcacgcacaccgcaagtgtgtgcctagttattaggca |
132 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45690434 |
gtaatacaattaaatggtaagggaaacaaaatgaaagtataaaggaggatgatagttgagagtgcacgcacaccgcaagtgtgtgcctagttattaggca |
45690335 |
T |
 |
| Q |
133 |
gatgattatgtatagattttattcaataaataaataaaatgtagatagatagatagatggtgttgttttgttcgggatggctatctatttttggagaaag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45690334 |
gatgattatgtatagattttattcaataaataaaatgtagacagatagatagatagatggtgttgttttgttcgggatggctatctatttttggagaaag |
45690235 |
T |
 |
| Q |
233 |
aaagagaatgtattaacattccatctaagcagttaattaatt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45690234 |
aaagagaatgtattaacattccatctaagcagttaattaatt |
45690193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University