View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_high_30 (Length: 226)
Name: NF14337_high_30
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 3446942 - 3446738
Alignment:
| Q |
19 |
tcgtcttcacaacatcaaaagggtaactgcagacccagctcgctacccctgctaatcctccagacaccaacatagtattcaaactttcttgaccactttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446942 |
tcgtcttcacaacatcaaaagggtaactgcagacccagctcgctacccccgctaatcctccagacaccaacatagtattcaaactttcttgaccactttt |
3446843 |
T |
 |
| Q |
119 |
tctacaacctggatgcaatttttccctcatgtattcatatgtccagaagtaaaaaccatgagaaggtatatccctcattatagtgatcccaagtcctcga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
3446842 |
tctacaacctggatgcaatttttccctcatgtattcatatgtccagaagtaaaaaccatgagaaggaatatccctcattatagtgataccaagccctcga |
3446743 |
T |
 |
| Q |
219 |
tatat |
223 |
Q |
| |
|
||||| |
|
|
| T |
3446742 |
tatat |
3446738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University