View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_high_31 (Length: 223)
Name: NF14337_high_31
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 670033 - 670219
Alignment:
| Q |
22 |
tgcgccaccatgaggagctctccctcccacccta----ctaatgatttcttaaatctaaannnnnnnnnncaaattttattataaccacaaaaagtaagt |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||||||||||||||| | ||||||||||||||||||||||||| || | |
|
|
| T |
670033 |
tgcgctaccatgaggagctctccctcccaacctagctactaatgatttcttaaatctacaaattttt---caaattttattataaccacaaaaagcaaat |
670129 |
T |
 |
| Q |
118 |
tttatgtcaagaaccatacaaaatacaactatgctttgtccttatagtgatccgcatttgctcatcaagaaagagattacaacaagtttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
670130 |
tttatgtcaagaaccatacaaaatacaactatgctttgtccttatagtgatctgcatttgctcatcaagaaagagattacaacaagtttg |
670219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University