View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_low_28 (Length: 255)
Name: NF14337_low_28
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 37159115 - 37159348
Alignment:
| Q |
1 |
aagccaaagactaaaatgcccctgacagcaagttaactgtcctcgatacggtgtaaatcgtaattcattcatttcgtgttgcagaatgtctatggaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37159115 |
aagccaaagactaaaatgcccctgacagcaagttaactgtcctcgatacggtgtaaatcgtaattcattcatttcgtgttgcagaatgtctatggaattc |
37159214 |
T |
 |
| Q |
101 |
aataccggtgtgcccgcagtcacaccaactcctacggaaaactgcagagaaagagggaagatgccgaattcggaaccggaattaggatcggaacaggaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
37159215 |
aataccggtgtgcccgcagtcacaccaactcctacggaaaactgcagagaaagagggaagatgccgaattcagaaccggaattaggatcggaacagggac |
37159314 |
T |
 |
| Q |
201 |
ccgaatccaaacccaaaccgcggggttctatttg |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| |
|
|
| T |
37159315 |
ccgaatctaaacccaaaccgcggggttctgtttg |
37159348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 37203866 - 37203937
Alignment:
| Q |
163 |
gccgaattcggaaccggaattaggatcggaacaggaacccgaatccaaacccaaaccgcggggttctatttg |
234 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37203866 |
gccgaaatcggaaccggaattaggatcggaacaggaacccgaatccaaacccaaaccgcggggttctatttg |
37203937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University