View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_low_30 (Length: 244)
Name: NF14337_low_30
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 47253497 - 47253286
Alignment:
| Q |
18 |
ttctccgagtctgcaaaataattaaccaagattttgacatgtatcactcatgtagggcccttatatgtactagacaacttagtctgtaacagacaagagt |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47253497 |
ttctccgagtctgcaaaataataaaccaagattttgacatgtatcactcatgtagggcccttatatgtactagataacttagtctgtaacagacaagagt |
47253398 |
T |
|
| Q |
118 |
aaagagctatgaaacaataacttaaatagtaccttctaattcagctattgggatagtgaagcatgtgtttgatttaagagaattagggaccacacatttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47253397 |
aaagagctatgaaacaataacttaaatagtaccttctaattcagctattgggatagtgaagcatgtgtttgatttaagagaattagggaccacacatttc |
47253298 |
T |
|
| Q |
218 |
ttgtctttttct |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47253297 |
ttgtctttttct |
47253286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University