View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14337_low_33 (Length: 226)

Name: NF14337_low_33
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14337_low_33
NF14337_low_33
[»] chr4 (1 HSPs)
chr4 (19-223)||(3446738-3446942)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 3446942 - 3446738
Alignment:
19 tcgtcttcacaacatcaaaagggtaactgcagacccagctcgctacccctgctaatcctccagacaccaacatagtattcaaactttcttgaccactttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
3446942 tcgtcttcacaacatcaaaagggtaactgcagacccagctcgctacccccgctaatcctccagacaccaacatagtattcaaactttcttgaccactttt 3446843  T
119 tctacaacctggatgcaatttttccctcatgtattcatatgtccagaagtaaaaaccatgagaaggtatatccctcattatagtgatcccaagtcctcga 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||    
3446842 tctacaacctggatgcaatttttccctcatgtattcatatgtccagaagtaaaaaccatgagaaggaatatccctcattatagtgataccaagccctcga 3446743  T
219 tatat 223  Q
    |||||    
3446742 tatat 3446738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University