View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_low_37 (Length: 209)
Name: NF14337_low_37
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 44501375 - 44501197
Alignment:
| Q |
19 |
ttatctcttcacgattcctctatctcactacacactctcaatttcagccataatggtcgcttggagtttcacctactcaaaaggattgtgaattgtgcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44501375 |
ttatctcttcacgattcctctatctcactacacactctcaatttcagccataatggttgcttggagtttcacctactcaaaaggattgtgaattgtgcta |
44501276 |
T |
 |
| Q |
119 |
ttttacacaaagtccagctgtcaggacttagtgtccttgctgacaatgcacaaattccgcctagcatattttcatctca |
197 |
Q |
| |
|
||| ||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44501275 |
tttcacacatagtccagcggtcaggacttagtgtccatgctgacaatgcacaaattccgcctagcatattttcatctca |
44501197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 73 - 147
Target Start/End: Complemental strand, 7976683 - 7976609
Alignment:
| Q |
73 |
ggtcgcttggagtttcacctactcaaaaggattgtgaattgtgctattttacacaaagtccagctgtcaggactt |
147 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||||||| |||||||| |||||| ||||||| || ||||||| |
|
|
| T |
7976683 |
ggtcgcttagagcctcacttactcaaaaggattgtgaattatgctatttcacacaatgtccagcggttaggactt |
7976609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University