View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14338_high_10 (Length: 238)
Name: NF14338_high_10
Description: NF14338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14338_high_10 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 51724 - 51946
Alignment:
| Q |
1 |
tttttgcgtatacatgatcggttgtttatatggtagggatcccatagttttttcccattgcttatattcgcttaagttaaatttattcacgcgttcaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
51724 |
tttttgcgtatacatgatcggttgtttaaatggtagggatcccatagttttttcccattgcttatattcgcttaagctaaatttattcacgcgttctccc |
51823 |
T |
|
| Q |
101 |
tgtatattattcaaccatggtttctgtcaagttagtttgttcactgatgctgcttttgaactcatgtgcttatacagtagattgtagattgccattttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
51824 |
tgtatattattcaaccatggtttctgtcaagttagtttgtgcattgatgctgcttttgaactcatgtgcttttacagtagattgcagattgccattttta |
51923 |
T |
|
| Q |
201 |
catttaaatttgcacgaataatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51924 |
catttaaatttgcacgaataatg |
51946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University