View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14338_low_11 (Length: 254)
Name: NF14338_low_11
Description: NF14338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14338_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 32015034 - 32014789
Alignment:
| Q |
9 |
acaacttctctgctgcggatttccaaagcattttgccatctaaatagaaaattcattcctcgatcacaaacagcaagacaaaacatgtgcttgtttctca |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
32015034 |
acaacttctctgctgcggatttcctaagcattttgccatctaaatagaaaattcattcctcgatcacaaacagcaagacaaaacaagtgcttgtttctta |
32014935 |
T |
|
| Q |
109 |
aaatgagatgatttcattgcttacaaatggaccatagtacagaagaagattgcttgatgtctttgactcaaaacctgcaaaatattaaacatagtttccc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32014934 |
aaatgagatgatttcattgcttacaaatggaccatagtacagaagaagattgcttgatgtctttgactcaaaaccagcaaaatattaaacatagtttccc |
32014835 |
T |
|
| Q |
209 |
tgatctctgtattttttattcagagcttgtgtaaattgagtccaaa |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32014834 |
tgatctctgtattttgtattcagagcttgtgtaaattgagtccaaa |
32014789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University