View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14339_low_3 (Length: 216)
Name: NF14339_low_3
Description: NF14339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14339_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 47674100 - 47674295
Alignment:
| Q |
1 |
aaaatagaaaatgatgctggactatatttcattttatacggattatcctctaatattaaaaggtttagtcctacttgctccattccaaattagcagttgt |
100 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47674100 |
aaaatagaaaatgatgctggaatatagttcattttatacggattatac-------------ggattagtcctacttgctccattccaaattagcagttgt |
47674186 |
T |
|
| Q |
101 |
ttaagattgctatgcaaatattaagaaaaataataataaatttgctaatggacatggtagttttactaaattaaccctattcgttaataaatgcatgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47674187 |
ttaagattgctatgcaaatattaagaaaagtaataataaatttgctaatggacatggtagttttactaaattaaccctattcgttaataaatgcatgctt |
47674286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University