View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_high_38 (Length: 299)
Name: NF1433_high_38
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 8e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 16 - 165
Target Start/End: Original strand, 31114517 - 31114667
Alignment:
| Q |
16 |
ttttctcccaatcaaataagcttt-agaaccaatgtccattcaaagaggtggatcccattatgccactcactctccattatctgcattgatgatagaagc |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114517 |
ttttctcccaatcaaataagcttttagaaccaatgtcctttctaagagttgggtcccattatgccactcactctccattatctgcattgatgatagaagc |
31114616 |
T |
 |
| Q |
115 |
ttgtatcccataaacacagtgaactgggttcactttggacgattcatggac |
165 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31114617 |
ttgtatcccagaaacacagtgaactgggttcactttggtcgattcatggac |
31114667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 233 - 291
Target Start/End: Original strand, 31114681 - 31114739
Alignment:
| Q |
233 |
ataaatgggttgaagcatcaaaacgacgtcatctttatctatccttggatgatgtccat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31114681 |
ataaatgggttgaagcatcaaaacgacgtcatctttatctatccttggttgatgtccat |
31114739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 80 - 192
Target Start/End: Original strand, 31088499 - 31088611
Alignment:
| Q |
80 |
actcactctccattatctgcattgatgatagaagcttgtatcccataaacacagtgaactgggttcactttggacgattcatggacgcaattatgttcaa |
179 |
Q |
| |
|
|||||||||| || || || ||||||||| |||||| |||| | |||||||| ||| |||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
31088499 |
actcactctctgttgtccgctttgatgatataagcttctatcaaagaaacacagagaagtgggttcactttcgttgattcgtggatacaattatgttcaa |
31088598 |
T |
 |
| Q |
180 |
cccccactctcaa |
192 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
31088599 |
cccacactctcaa |
31088611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University