View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_high_41 (Length: 283)
Name: NF1433_high_41
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_high_41 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 24 - 283
Target Start/End: Original strand, 23711911 - 23712170
Alignment:
| Q |
24 |
aaacaagaacaaatcaatatcaataataataaatgtggctactttgaattgaaaacgtggagaaggatgggtcaaggtggtcttagttgtagaggtagtc |
123 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23711911 |
aaacaagaacaactcaatatcaataataataaatgtggctactttgaattgaaaacgtggagaaggatgggtcaaggtggtcttagttgtagaggtagtc |
23712010 |
T |
 |
| Q |
124 |
atgaacatggactctttcgtgctgtccaacatggtgacctgaaaactgtttctactcctttacagactcacccttctcttctcaatcgtactactgttta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23712011 |
atgaacatggactctttcgtgctgtccaacatggtgacctcaaaactgtttctactcttttacagactcacccttctcttctcaatcgtactaccgttta |
23712110 |
T |
 |
| Q |
224 |
tgatcatcattcccctcttcatattgctgctgccaatggtcagatccaggttcaattctt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23712111 |
tgatcatcattcccctcttcatattgctgctgccaatggtcagatccaggttcaattctt |
23712170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University