View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_high_45 (Length: 278)
Name: NF1433_high_45
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 262
Target Start/End: Original strand, 4124207 - 4124461
Alignment:
| Q |
8 |
gagatgaatgaaagcgtggcggttggcgtaagcggagatgtcggttacgtcgccgaaacgttcggcgaggtttttgagagatagggcggcgttgtagggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4124207 |
gagatgaatgaaagcgtggcggttggcgtaagcggagatgtcggttacgtcgccgaaacgttcggcgaggtttttgagagatacggcggcgttgtagggt |
4124306 |
T |
 |
| Q |
108 |
ggtccgcgtggtggtttgttgtcgaggtcccagaggacacagactttgttctgtttttgttcgtaggttccttgtttggtttttaccatgtcgatgtcga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4124307 |
ggtccgcgtggtggtttgttgtcgaggtcccagaggacacagactttgttctgtttttgttcgtaggttccttgtttggtttttaccatgtcgatgtcgt |
4124406 |
T |
 |
| Q |
208 |
ttatgttgttgttgttggtagaacagcattggatacgaggttggggttttggttt |
262 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4124407 |
cgattatgttgttgttggtagaacaacattggatacgaggttggggttttggttt |
4124461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 54 - 144
Target Start/End: Complemental strand, 5659883 - 5659793
Alignment:
| Q |
54 |
acgtcgccgaaacgttcggcgaggtttttgagagatagggcggcgttgtagggtggtccgcgtggtggtttgttgtcgaggtcccagagga |
144 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||| || ||||||||||| |||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
5659883 |
acgtcgccgaagcgttcggcgaaggttttgagagagagtgcggcgttgtatggtggtccatgtggtggtttgttgtcgaggtcccatagga |
5659793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University