View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_high_61 (Length: 246)
Name: NF1433_high_61
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_high_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 43 - 201
Target Start/End: Original strand, 19681377 - 19681535
Alignment:
| Q |
43 |
tcatttatgacataatggttgaccaatgtcacctgacattgataccttaatgtcacccaaatactacctttcattcttatactttattgtagctcccgat |
142 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19681377 |
tcatttgtgacatagtggttgaccaatgtcacctgacattgataccttaatgtcacccaaatactacctttcattcttatactttattgtagctcccgat |
19681476 |
T |
 |
| Q |
143 |
tttcccctactttcgtatcatttatcttaactttatgttatattcaaaaactaaaatca |
201 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19681477 |
tttcccctactttcgcaacatttatcttaactttatgttatattcaaaaactaaaatca |
19681535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 42494885 - 42494937
Alignment:
| Q |
58 |
tggttgaccaatgtcacctgacattgataccttaatgtcacccaaatactacc |
110 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
42494885 |
tggttgaccaatgtcacatgacattggcaccacaatgtcacccaaatactacc |
42494937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 102
Target Start/End: Original strand, 22616647 - 22616691
Alignment:
| Q |
58 |
tggttgaccaatgtcacctgacattgataccttaatgtcacccaa |
102 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
22616647 |
tggttgatcaatgtcacatgacattgatacctcagtgtcacccaa |
22616691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 102
Target Start/End: Original strand, 26960953 - 26960997
Alignment:
| Q |
58 |
tggttgaccaatgtcacctgacattgataccttaatgtcacccaa |
102 |
Q |
| |
|
|||||| |||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
26960953 |
tggttggccaatgtcacatgacattgacacctcaatgtcacccaa |
26960997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University