View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1433_high_72 (Length: 237)

Name: NF1433_high_72
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1433_high_72
NF1433_high_72
[»] chr2 (3 HSPs)
chr2 (1-134)||(32075663-32075798)
chr2 (146-224)||(32072195-32072273)
chr2 (192-224)||(32064915-32064947)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 32075663 - 32075798
Alignment:
1 tctatgtgaggtgcattttcaggtatcctactctttgacccaaaaatagnnnnnnn--ttgccagactcaaccaattaggcaaataagaagatatcatag 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||| ||||||||||||||||||||    
32075663 tctatgtgaggtgcattttcaggtatcctactctttgacccaaaaatagaaaaaaaaattgccagactcaaccaattagacaaataagaagatatcatag 32075762  T
99 tagcatatgtcttactctcggtgatagtgatttttc 134  Q
    |||||| |||||||||||||| |||| |||||||||    
32075763 tagcatctgtcttactctcggcgatattgatttttc 32075798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 224
Target Start/End: Original strand, 32072195 - 32072273
Alignment:
146 gatggtgtttggcaagttatgtacactctctttgatagaattttttatgagagtgagtgtcaattgccagagagatgtg 224  Q
    |||||||||||| |||| |  ||||||||||||||||||  |||| |||||||||| |||||||||||| |||||||||    
32072195 gatggtgtttggaaagtgacatacactctctttgatagagattttgatgagagtgaatgtcaattgccaaagagatgtg 32072273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 224
Target Start/End: Original strand, 32064915 - 32064947
Alignment:
192 atgagagtgagtgtcaattgccagagagatgtg 224  Q
    |||||||||||||||||||||||||||||||||    
32064915 atgagagtgagtgtcaattgccagagagatgtg 32064947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University