View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1433_high_92 (Length: 203)

Name: NF1433_high_92
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1433_high_92
NF1433_high_92
[»] chr5 (1 HSPs)
chr5 (26-183)||(40322437-40322594)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 26 - 183
Target Start/End: Complemental strand, 40322594 - 40322437
Alignment:
26 tgctagttaatacttaataccccataacnnnnnnntatggtgctactagttttgtttcaatttatcttttcgcttgaaaaatcagaaaagtattgatcat 125  Q
    ||||||||||||||||||||||||||||       ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||    
40322594 tgctagttaatacttaataccccataacaaaaaaatatggtgctacaagttttgtttcaatttatcttttcgcttgaaaaatcagaaaagtattaatcat 40322495  T
126 ggtttttcaatttgatcccccagttcgtttgttatctaaatcaaatgaaattatagaa 183  Q
    |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||    
40322494 ggtttttcaatttgatcccctagttcgtttgttatctcaatcaaatgaaattatagaa 40322437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University