View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_100 (Length: 201)
Name: NF1433_low_100
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_100 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 49086049 - 49085862
Alignment:
| Q |
1 |
aaaaggcacagaaataatgtaagaacggacgaaatcattcctgcaaatgcaattcttccagctaaaagcaggatcttggcctcatcgttattagacataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49086049 |
aaaaggcacagaaataatgtaagaacggacgaaatcattcctgcaaatgcaattcttccagctaaaagcaggatcttggcttcatcgttattagacataa |
49085950 |
T |
 |
| Q |
101 |
gcatactagttaaaccacagccctaacaagtaagatt----tacacgaggtacaataaaaaattcaaatcaatcactacataataatt |
184 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085949 |
gcatgctagttaaaccacagccctaacaagtaagatttaaataaacgaggtacaataaaaaattcaaatcaatcactacataataatt |
49085862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University