View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_30 (Length: 334)
Name: NF1433_low_30
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 69 - 283
Target Start/End: Complemental strand, 6267330 - 6267117
Alignment:
| Q |
69 |
aaatccttttatcggtgaaccataaaaaatacagttaaatttaattgatggtataaatttattataaataaaaatgagactgattaatctattccaaaat |
168 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
6267330 |
aaatccttttattggtgaaccataaaaaatacagttaaatttaattgatggtataaatttattataaataaaaatgagactgattaatctgttcc-aaat |
6267232 |
T |
|
| Q |
169 |
tctgcaactcaccaaaattctgcaaaagatgcttgctgcaaatnnnnnnnttgtgacagattaatctattcccccatatctctatagttgaatgcaggaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6267231 |
tctgcaactcaccaaaattctgcaaaagatgcttgctgcaaataaaaaaattgtgacagattaatctattcccccatatctctatagttgaatgaaggaa |
6267132 |
T |
|
| Q |
269 |
atggtactcatgatg |
283 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6267131 |
atggtactcatgatg |
6267117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University