View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_47 (Length: 280)
Name: NF1433_low_47
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 27762191 - 27762442
Alignment:
| Q |
14 |
ttctttaccttattgagcttggaaggactcacttttcacttaaattaagacattaaactctcatctcttcaaaccgaccctcaaatttagttagttgggg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27762191 |
ttctttaccttattgagcttggaaggactcacttttgacttaaattaagacattacactctcatctcttcaaaccgaccctcaaatttagttagttgggg |
27762290 |
T |
|
| Q |
114 |
acaataagcggcgagtagcacgcgacacaagtgagtgtttgtttatctccatcactaactcaagtcaccaccgtcaaattcaattccatttccacacaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27762291 |
acaataagcggcgagtagcacgcgacacaagtgagtgtttgtttatctccatcactaactcaagtcaccaccgtcaaattcaattccatttccacacaac |
27762390 |
T |
|
| Q |
214 |
caaacacatccttatccaaacctaaccaccactctcttcccattactatatc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27762391 |
caaacacatccttatccaaacctaaccaccactctctttccattactatatc |
27762442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University