View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_51 (Length: 275)
Name: NF1433_low_51
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 38270779 - 38270956
Alignment:
| Q |
17 |
ctgatattgatctttagtaattattattttactgagtccaaacaactgaaggtgttaattttgtgaacggtctggtttgaaagtctttgtagatttcaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38270779 |
ctgatattgatctttagtaattattattttactgagtccaaacaactgaaggtgttaattttgtgaacggtctggtttgaaagtctttgtagatttcaat |
38270878 |
T |
 |
| Q |
117 |
gtatcattatttaatgataatcttagatatgttggatgccttcaggaagatgtgcctccaaatgaacaacatgaagtt |
194 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
38270879 |
gtatcattatttgatgataatcttagatatgttggatgccttaaggaagatgtgcatccaaatgaacaagatgaagtt |
38270956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 36 - 192
Target Start/End: Original strand, 38278679 - 38278840
Alignment:
| Q |
36 |
attattattttactgagtccaaacaactgaaggtgttaattttgtgaac-----ggtctggtttgaaagtctttgtagatttcaatgtatcattatttaa |
130 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||| ||||||||||||||||| | |
|
|
| T |
38278679 |
attatcattttactgagtccaaacaactgaaggtgttaattttgagaatagaatggtctggtttgaaagtctttatagatctcaatgtatcattatttga |
38278778 |
T |
 |
| Q |
131 |
tgataatcttagatatgttggatgccttcaggaagatgtgcctccaaatgaacaacatgaag |
192 |
Q |
| |
|
|||| ||||||| ||||||||||| ||| ||| |||||||| |||||| |||||| |||||| |
|
|
| T |
38278779 |
tgatgatcttagttatgttggatggcttaaggcagatgtgcatccaaacgaacaagatgaag |
38278840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University