View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_54 (Length: 258)
Name: NF1433_low_54
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 127 - 239
Target Start/End: Original strand, 45098483 - 45098595
Alignment:
| Q |
127 |
ttgtatagatagacaaggtttctgtacttggtgaagctattaattacgtgaaagaacttaaagaacgcatatcaatgctggagcaacaatattatgagag |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098483 |
ttgtatagatagacaaggtttctgtacttggtgaagctattaattacgtgaaagaacttaaagaacgcatatcaatgctggagcaacaatattatgagag |
45098582 |
T |
 |
| Q |
227 |
gaataaaagtacc |
239 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45098583 |
gaataaaagtacc |
45098595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 45097370 - 45097470
Alignment:
| Q |
8 |
caaacaagttattatcatggtcaaactaatttgttattgtagtcagaaattgagaaatatttgtgtaatttattatggtctcactttgatactacacggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45097370 |
caaacaagttattatcatggtcaaact---ttgttattgtagtcagaaattgagaaatatttgtgtaatttattatggtctcactttgatactacacggt |
45097466 |
T |
 |
| Q |
108 |
aaat |
111 |
Q |
| |
|
|||| |
|
|
| T |
45097467 |
aaat |
45097470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University