View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_55 (Length: 258)
Name: NF1433_low_55
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 64 - 241
Target Start/End: Original strand, 410133 - 410310
Alignment:
| Q |
64 |
ttgataatttttgcaggaaaatggctaagaagcaagtatgtgggagtatctatggttgggaaaacattagcaataatgggatttggaaaagttggatctg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
410133 |
ttgataatttttgcaggaaaatggctgagaagcaagtatgttggagtatctatggttgggaaaacattagcaataatggggtttggaaaagttggatctg |
410232 |
T |
 |
| Q |
164 |
aagttgcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410233 |
aagttgcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtg |
410310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 91 - 231
Target Start/End: Original strand, 48785408 - 48785548
Alignment:
| Q |
91 |
agaagcaagtatgtgggagtatctatggttgggaaaacattagcaataatgggatttggaaaagttggatctgaagttgcaaggcgtgcaaaaggattag |
190 |
Q |
| |
|
||||| |||||||| ||||| || | |||||||| ||| | || ||||||||||||| || |||||| |||| ||||| |||||||| || || | | |
|
|
| T |
48785408 |
agaagtaagtatgttggagtttccctagttgggaagacacttgctgtaatgggatttgggaaggttggaactgaggttgctaggcgtgctaaggggcttg |
48785507 |
T |
 |
| Q |
191 |
gaatgaatgtgattgctcatgacccttatgctccagctgat |
231 |
Q |
| |
|
| ||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
48785508 |
gtatgaaggttattgctcatgatccttatgctcctgctgat |
48785548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University