View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_62 (Length: 248)
Name: NF1433_low_62
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 32769493 - 32769255
Alignment:
| Q |
1 |
attgaagaaggatgcagcagcagaagcagacgaaggagaaatcaatggtggagtggacaaattataatttggccttgggagtatcgtattctttaacaaa |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32769493 |
attgaagaaggatgcagtagcagaagcagacgaagtagaaatcaatggtgga-----caaattataatttagccttgggagtatcgtattctttaacaaa |
32769399 |
T |
|
| Q |
101 |
attcataacaagtacagacattaatattttatgtttcaataa-aaatactaaaataatgaacagtgtacgatgtactacagtgtctgtctctaactccta |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32769398 |
attcatgacaagtacagacattaatattttatgtttcaataacaaatactaaaataatgaacagtgtactatgtactacagtgtctgtctctaactccta |
32769299 |
T |
|
| Q |
200 |
gctttttcccatttctcaatattaattttcacagttcatctcac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
32769298 |
gctttttcccatttctcaatattaattttcacagtccttctcac |
32769255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University