View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1433_low_63 (Length: 247)

Name: NF1433_low_63
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1433_low_63
NF1433_low_63
[»] chr6 (1 HSPs)
chr6 (57-95)||(32942659-32942697)
[»] chr2 (1 HSPs)
chr2 (57-95)||(11316610-11316648)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 32942659 - 32942697
Alignment:
57 ttgaattttcaaaacctgctgagaaagagggagtagtag 95  Q
    |||||||||||||||||||||||||||||||||||||||    
32942659 ttgaattttcaaaacctgctgagaaagagggagtagtag 32942697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 11316610 - 11316648
Alignment:
57 ttgaattttcaaaacctgctgagaaagagggagtagtag 95  Q
    |||||||||||||||||||||||||| | ||||||||||    
11316610 ttgaattttcaaaacctgctgagaaaaatggagtagtag 11316648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University