View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_63 (Length: 247)
Name: NF1433_low_63
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 32942659 - 32942697
Alignment:
| Q |
57 |
ttgaattttcaaaacctgctgagaaagagggagtagtag |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32942659 |
ttgaattttcaaaacctgctgagaaagagggagtagtag |
32942697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 11316610 - 11316648
Alignment:
| Q |
57 |
ttgaattttcaaaacctgctgagaaagagggagtagtag |
95 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
11316610 |
ttgaattttcaaaacctgctgagaaaaatggagtagtag |
11316648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University