View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_75 (Length: 239)
Name: NF1433_low_75
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 41274778 - 41274552
Alignment:
| Q |
1 |
tttcttttttatggcatatctctgttttttctatctcccttcgggaatgcttgagaaagcaagggctgtctgtattcatttatatttctttgtgcatttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41274778 |
tttcttttttatggcatatctctgttttttctatctcccttcgggaatgcttgagaaagcaagggctgtctgtattcatttatatttctttgtccatttg |
41274679 |
T |
 |
| Q |
101 |
ggaccctattt-ctgtgatttaaatttagtcacgtttgttcattttgattagtagtaacttgtagttcatagatagataaaataaggttcttcacattta |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41274678 |
ggaccctattttctgtgatttaaatttagtcacgtttgttcattttgattagtagtaacttgtagttcatagatagataaaataaggttcttcacattta |
41274579 |
T |
 |
| Q |
200 |
caattagtattttgcagtagatttgat |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41274578 |
caattagtattttgcagtagatttgat |
41274552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University