View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_77 (Length: 237)
Name: NF1433_low_77
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 32075663 - 32075798
Alignment:
| Q |
1 |
tctatgtgaggtgcattttcaggtatcctactctttgacccaaaaatagnnnnnnn--ttgccagactcaaccaattaggcaaataagaagatatcatag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32075663 |
tctatgtgaggtgcattttcaggtatcctactctttgacccaaaaatagaaaaaaaaattgccagactcaaccaattagacaaataagaagatatcatag |
32075762 |
T |
 |
| Q |
99 |
tagcatatgtcttactctcggtgatagtgatttttc |
134 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
32075763 |
tagcatctgtcttactctcggcgatattgatttttc |
32075798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 224
Target Start/End: Original strand, 32072195 - 32072273
Alignment:
| Q |
146 |
gatggtgtttggcaagttatgtacactctctttgatagaattttttatgagagtgagtgtcaattgccagagagatgtg |
224 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||||||| |||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
32072195 |
gatggtgtttggaaagtgacatacactctctttgatagagattttgatgagagtgaatgtcaattgccaaagagatgtg |
32072273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 224
Target Start/End: Original strand, 32064915 - 32064947
Alignment:
| Q |
192 |
atgagagtgagtgtcaattgccagagagatgtg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32064915 |
atgagagtgagtgtcaattgccagagagatgtg |
32064947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University