View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_79 (Length: 237)
Name: NF1433_low_79
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 114 - 221
Target Start/End: Original strand, 32769619 - 32769720
Alignment:
| Q |
114 |
tcaattcggtgctctccttgattccaaccatttcccatgattagaagttgaatagagtactgtgaattattattaattgtagaatacttgatatgagtca |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32769619 |
tcaattcggttctctccttgattccaaccatttcccatgattagaagttgaatagag---tgtga---attattaattgtagaatacttgatatgagtca |
32769712 |
T |
 |
| Q |
214 |
taaaaaag |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
32769713 |
taaaaaag |
32769720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 32769511 - 32769571
Alignment:
| Q |
1 |
ttctcagctacatataaatatttgttgaaagataacacatctcaaatgggatcacatactc |
61 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32769511 |
ttctcagctacatattaatatttgttgaaagataacacatctcaaatgggatcacatactc |
32769571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University