View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_80 (Length: 236)
Name: NF1433_low_80
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 52 - 220
Target Start/End: Original strand, 11835717 - 11835890
Alignment:
| Q |
52 |
tggttttgattttgtcatgtttgtgtaactgtgatgaaaaatagtgaaggatttgtgcggttttatagagaaggattgaggcatgagggcactgtgtta- |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835717 |
tggttttgattttgtcatgtttgtgtaactgtgatgaaaaatagtgaaggatttgtgcggttttatagagaaggattgaggcatgagggcactgtgttat |
11835816 |
T |
 |
| Q |
151 |
----ttgggagttatggttcaaatatctgttgtatatggggccatgcagacaaaatcttgtggctactattttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835817 |
tatcttgggagttatggttcaaatatctgttgtatatggggccatgcagacaaaatcttgtggctactattttt |
11835890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University