View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_85 (Length: 230)
Name: NF1433_low_85
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 80 - 213
Target Start/End: Original strand, 52719895 - 52720027
Alignment:
| Q |
80 |
gagaccaaaacatataacggagaaggacttaagagatctaaacgaattttttattacttgactaaagcgatactnnnnnnnnnnncgttaagggaccaaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
52719895 |
gagaccaaaacatataacggagaaggacttaagagatctaaacggactttttattacttgactaaagcaatactaaaaaaaaaag-gttaagggaccaaa |
52719993 |
T |
|
| Q |
180 |
acaacattttagcctataattaatacccttaatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
52719994 |
acaacattttagcctataattaataccctaaatg |
52720027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 13 - 79
Target Start/End: Original strand, 52719697 - 52719763
Alignment:
| Q |
13 |
gagaagaaaaggaagaaagggaaaaacaatatgagatggtgatggtgtactattacttacaatagat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52719697 |
gagaagaaaaggaagaaagggaaaaacaatatgagatggtgatggtgtactattacttacaatagat |
52719763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University