View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_86 (Length: 230)
Name: NF1433_low_86
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 12313756 - 12313554
Alignment:
| Q |
18 |
ttaattgtgatggctttttaggtggtccatcaattatttattctatgttaa----------gnnnnnnntatcttgcttatcactttgccaattatagcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
12313756 |
ttaattgtgatggctttttaggtggtccatcaattatttattctatgttaatatccaaacagaaaaaaatatcttgcttatcactttgccaattatagcc |
12313657 |
T |
 |
| Q |
108 |
taaattgatttttacgaagttggctatatgtttgtgtttatttaggaatacaaaatgggactatatactacaaaatcatgtgacttaggtgtttgcttac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12313656 |
taaattgatttttacgaagttggctatatgattgtgtttatttaggaatacaaaatgggactatatactacaaaatcatgtgacttaggtgtttgcttac |
12313557 |
T |
 |
| Q |
208 |
gta |
210 |
Q |
| |
|
||| |
|
|
| T |
12313556 |
gta |
12313554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University