View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_93 (Length: 217)
Name: NF1433_low_93
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_93 |
 |  |
|
| [»] scaffold0184 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0184 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0184
Description:
Target: scaffold0184; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 12 - 202
Target Start/End: Original strand, 12399 - 12589
Alignment:
| Q |
12 |
aggagcagagattaaaccaacaagtggtggtgttgttgatgaagaacataatgaagagattgtggtatgaaaagatggcatggattgtgatactgcaagt |
111 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
12399 |
aggatcagtgattaaagcaacaagtggtggtgttgttgatgaagaacataatgaagagattgtggtatgaaaagatggcatggattgtgagactgctagt |
12498 |
T |
 |
| Q |
112 |
tggatttggactgctggagagagattttgtgggagagattttttgttgattggagggaggaaagtgtatgtaatatttgaaggaagagatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12499 |
tggatttggactgctggagagagattttgtgggagagattttttgttgattggagggaggaaagtgtatgtaatatttgaaggaagagatt |
12589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 60445 - 60255
Alignment:
| Q |
12 |
aggagcagagattaaaccaacaagtggtggtgttgttgatgaagaacataatgaagagattgtggtatgaaaagatggcatggattgtgatactgcaagt |
111 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
60445 |
aggatcagtgattaaagcaacaagtggtggtgttgttgatgaagaacataatgaagagattgtggtatgaaaagatggcatggattgtgagactgctagt |
60346 |
T |
 |
| Q |
112 |
tggatttggactgctggagagagattttgtgggagagattttttgttgattggagggaggaaagtgtatgtaatatttgaaggaagagatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60345 |
tggatttggactgctggagagagattttgtgggagagattttttgttgattggagggaggaaagtgtatgtaatatttgaaggaagagatt |
60255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University