View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1433_low_99 (Length: 203)
Name: NF1433_low_99
Description: NF1433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1433_low_99 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 26 - 183
Target Start/End: Complemental strand, 40322594 - 40322437
Alignment:
| Q |
26 |
tgctagttaatacttaataccccataacnnnnnnntatggtgctactagttttgtttcaatttatcttttcgcttgaaaaatcagaaaagtattgatcat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40322594 |
tgctagttaatacttaataccccataacaaaaaaatatggtgctacaagttttgtttcaatttatcttttcgcttgaaaaatcagaaaagtattaatcat |
40322495 |
T |
 |
| Q |
126 |
ggtttttcaatttgatcccccagttcgtttgttatctaaatcaaatgaaattatagaa |
183 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40322494 |
ggtttttcaatttgatcccctagttcgtttgttatctcaatcaaatgaaattatagaa |
40322437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University