View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14340_high_22 (Length: 288)
Name: NF14340_high_22
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14340_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 196 - 268
Target Start/End: Complemental strand, 34381167 - 34381095
Alignment:
| Q |
196 |
tattcgttgctcaagaaggcgacacactcaccacttctctagaggaagaagctggattgagtctcgattggga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34381167 |
tattcgttgctcaagaaggcgacacactcaccacttctctagacgaagaagctggattgagtctcgattggga |
34381095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 34381338 - 34381275
Alignment:
| Q |
19 |
tgtctatcacttccaacactccactcttcaaatccctaaccatggccgaatcctgcctcctctc |
82 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381338 |
tgtctatcacttccaccactccactcttcaaatccctaaccatggccgaatcctgcctcctctc |
34381275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University