View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14340_high_27 (Length: 259)
Name: NF14340_high_27
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14340_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 5 - 136
Target Start/End: Original strand, 35685784 - 35685915
Alignment:
| Q |
5 |
atgaatgcaaaacggtacaagtgatgggcttcaatcaatcttgtgtgaaaaatgaagtnnnnnnnnnnnnngttgcctttgacataaacacagcaacaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| || ||||||| |
|
|
| T |
35685784 |
atgaatgcaaaacggtacaagtgatgggcttcaatcaatcttgtgtgaaaactgaagtaaaaagaaaaaatgttgcctttgacataaacgcaacaacaaa |
35685883 |
T |
 |
| Q |
105 |
aatcaatcataatgaaagaaattggatgatca |
136 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
35685884 |
aatcaatcataatgcaagaaattggatgatca |
35685915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University