View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14340_high_27 (Length: 259)

Name: NF14340_high_27
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14340_high_27
NF14340_high_27
[»] chr1 (1 HSPs)
chr1 (5-136)||(35685784-35685915)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 5 - 136
Target Start/End: Original strand, 35685784 - 35685915
Alignment:
5 atgaatgcaaaacggtacaagtgatgggcttcaatcaatcttgtgtgaaaaatgaagtnnnnnnnnnnnnngttgcctttgacataaacacagcaacaaa 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||             |||||||||||||||||| || |||||||    
35685784 atgaatgcaaaacggtacaagtgatgggcttcaatcaatcttgtgtgaaaactgaagtaaaaagaaaaaatgttgcctttgacataaacgcaacaacaaa 35685883  T
105 aatcaatcataatgaaagaaattggatgatca 136  Q
    |||||||||||||| |||||||||||||||||    
35685884 aatcaatcataatgcaagaaattggatgatca 35685915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University