View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14340_high_33 (Length: 223)
Name: NF14340_high_33
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14340_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 38625068 - 38624882
Alignment:
| Q |
19 |
catgtccctcaccacaaaaatcgcaccttaaagtttgtgcttgttgaacctgttgaacttgcgcttgttgggcttgaacttgtcccatactcatggctat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||| | |
|
|
| T |
38625068 |
catgtccctcaccacaaaaatcgcaccttaaagtttgtgcttgttgaacctgttgaacttgcgcttgctgggcttgtatttgtcccatactcatggcttt |
38624969 |
T |
 |
| Q |
119 |
tacttgtttggtatgtgctctaatttgttactcattaaggtttgattggccagcatatcactattctcattcaccctaaacactcctttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
38624968 |
tacttgtttggtatgtgctctaatttgttactcattaaggtttgattgaccaacatatcac---tctcattcaccctaaacactcctttg |
38624882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 17843392 - 17843490
Alignment:
| Q |
19 |
catgtccctcaccacaaaaatcgcaccttaaagtttgtgcttgttgaacctgttgaacttgcgcttgttgggcttgaac-ttgtcccatactcatggct |
116 |
Q |
| |
|
||||||| ||||||||||| ||||| || ||| ||||| |||||||| ||||||||||| | |||||| ||||||| ||||| |||||| |||||| |
|
|
| T |
17843392 |
catgtccttcaccacaaaactcgcatctcaaaacttgtgtttgttgaatctgttgaacttaagtttgttgaacttgaactttgtctcatacttatggct |
17843490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 21021529 - 21021589
Alignment:
| Q |
19 |
catgtccctcaccacaaaaatcgcaccttaaagtttgtgcttgttgaacctgttgaacttg |
79 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||| ||||| ||| |||| |||||||||||| |
|
|
| T |
21021529 |
catgtccttcaccacaaaattcgcacctcaaaacttgtggttggtgaatctgttgaacttg |
21021589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University