View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14340_high_38 (Length: 215)

Name: NF14340_high_38
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14340_high_38
NF14340_high_38
[»] chr8 (2 HSPs)
chr8 (15-96)||(16344373-16344454)
chr8 (131-198)||(16344455-16344518)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 15 - 96
Target Start/End: Original strand, 16344373 - 16344454
Alignment:
15 atgaaaagattttgagggtggaattgctgagttccagattatcttggaccaatctttcttgctattatgagtacagtggaag 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16344373 atgaaaagattttgagggtggaattgctgagttccagattatcttggaccaatctttcttgctattatgagtacagtggaag 16344454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 131 - 198
Target Start/End: Original strand, 16344455 - 16344518
Alignment:
131 gggtgtctttccatatgaacttatcagctttatgcctccaaggaatagtgagtgattttattaatatg 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||    
16344455 gggtgtctttccatatgaacttatcagctttatgcctccaaggaatagtg----attttattaatatg 16344518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University