View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14340_high_38 (Length: 215)
Name: NF14340_high_38
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14340_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 15 - 96
Target Start/End: Original strand, 16344373 - 16344454
Alignment:
| Q |
15 |
atgaaaagattttgagggtggaattgctgagttccagattatcttggaccaatctttcttgctattatgagtacagtggaag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16344373 |
atgaaaagattttgagggtggaattgctgagttccagattatcttggaccaatctttcttgctattatgagtacagtggaag |
16344454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 131 - 198
Target Start/End: Original strand, 16344455 - 16344518
Alignment:
| Q |
131 |
gggtgtctttccatatgaacttatcagctttatgcctccaaggaatagtgagtgattttattaatatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16344455 |
gggtgtctttccatatgaacttatcagctttatgcctccaaggaatagtg----attttattaatatg |
16344518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University