View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14340_low_27 (Length: 270)
Name: NF14340_low_27
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14340_low_27 |
 |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 100 - 249
Target Start/End: Original strand, 929746 - 929895
Alignment:
| Q |
100 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagcaaaatgcattagattgtatccatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
929746 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagaaaaatgcattagattgtatccatc |
929845 |
T |
 |
| Q |
200 |
catacacgataaatgtgagaatttcctacctttcttcccacctttgatac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
929846 |
catacacgataaatgtgagaatttcctacctttcttaccacctttgatac |
929895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 87
Target Start/End: Original strand, 929642 - 929676
Alignment:
| Q |
53 |
ataaccgtttaacggtttagtcctcgattccatcc |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
929642 |
ataacagtttaacggtttagtcctcgattccatcc |
929676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 249
Target Start/End: Complemental strand, 24981 - 24941
Alignment:
| Q |
209 |
taaatgtgagaatttcctacctttcttcccacctttgatac |
249 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
24981 |
taaatgtgagcatttcctatctttcttaccacctttgatac |
24941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University