View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14340_low_29 (Length: 262)

Name: NF14340_low_29
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14340_low_29
NF14340_low_29
[»] chr2 (1 HSPs)
chr2 (13-245)||(13831159-13831389)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 13831389 - 13831159
Alignment:
13 cagataatttaaataattatatagacataactaagtttagaaagagattcaaataaaaatcgagagactctcaaatgacaacaaaaaatatctattcgtg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||  |||||||||||||||||||||||||||||||||    
13831389 cagataatttaaataattatatagacataactaagtttagaaagagattgaaataaaaatcgaga--ctctcaaatgacaacaaaaaatatctattcgtg 13831292  T
113 cgtttgcgacgaatgttctctttactttagctttgtcctttatttacacgagtatcacttgttaaattggattagtttaactcataaagtaatatgatca 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
13831291 cgtttgcgacgaatgttctctttactttagctttgtcctttatttacacgattatcacttgttaaattggattagtttaactcataaagtaatatgatca 13831192  T
213 tcagttaatcacggaagacaaatcgataagcat 245  Q
    |||||||||||||||||||||||||||||||||    
13831191 tcagttaatcacggaagacaaatcgataagcat 13831159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University