View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14340_low_3 (Length: 590)
Name: NF14340_low_3
Description: NF14340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14340_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 40308195 - 40307960
Alignment:
| Q |
17 |
aaactcaagttgaacttttattgtgattgtgatgttactcacttgtaacggtccttgccacaaaaaccggacagttatgtaccggaaatttcacatggta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40308195 |
aaactcaagttgaacttttattgtgattgtgatgttactcacttgtaacggtccttgccacaaaaaccggacagttatgtaccggaaatttcacatggta |
40308096 |
T |
|
| Q |
117 |
gaacagtataaaataagagttaataatcttaaaaacaccaggcattgtttctggatgttatgtttggttggttggatctatacc-nnnnnnnnatatccc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40308095 |
gaacagtataaaataagagttaataatcttaaaaacaccaggcattgtttctggatgttatgtttggttggttggatctatacctttttttttatatccc |
40307996 |
T |
|
| Q |
216 |
ttatccacgggaaaaaagggactgctatctcgtaag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40307995 |
ttatccacgggaaaaaagggactgctatctcgtaag |
40307960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 432 - 584
Target Start/End: Complemental strand, 40307932 - 40307777
Alignment:
| Q |
432 |
ttgcattttcttttttgcaagattaattgagtcatac---agcttttagttagaggactctgtttattttacacgggcctccaattcaattttaataaca |
528 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40307932 |
ttgcattttcttttttgcaagattaattgagtcatacggtagcttttagttagaggactctgtttattttacacgggcctccaattcaattttaataaca |
40307833 |
T |
|
| Q |
529 |
atccaaacaaatttcaattgcataattagacgagttttactttttccaccctatgc |
584 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40307832 |
atccaaacaaatttcaatttcataattagacgagttttacttttcccaccctatgc |
40307777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University