View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14341_low_5 (Length: 230)
Name: NF14341_low_5
Description: NF14341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14341_low_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 3602955 - 3603176
Alignment:
| Q |
1 |
tcgtatgctttgatttttgtttcttagcttatattaatttttcttctcaagcttgaatagaactttaatcgtgtgtttcaagtgatttgcttttgtacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3602955 |
tcgtatgctttgatttttgtttcttagcttatattaatttttcttctcaagctcgaatagaactttaatcgtgtgtttcaagtgatttacttttgtacat |
3603054 |
T |
 |
| Q |
101 |
aaattggattttcaaacaacctgcacggctgcacgtgaaccggttcttatgtttaaaacggggttcaaaccagcttggcaccaatttacaatttcaaacc |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3603055 |
aaattggattttcaaacaac--------ctgcacgtgaaccggttcttatgtttaaaacggggttcaaaccagtttggcaccaatttacaatttcaaacc |
3603146 |
T |
 |
| Q |
201 |
gctttacattttttcatgaaatggtttggt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3603147 |
gctttacattttttcatgaaatggtttggt |
3603176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University