View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14343_high_20 (Length: 329)

Name: NF14343_high_20
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14343_high_20
NF14343_high_20
[»] chr4 (1 HSPs)
chr4 (1-312)||(158092-158403)


Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 158092 - 158403
Alignment:
1 gatattcaaaagaaggtgggatttacttttactatggaagatgtaagtactacgacaaaattggtagagttggaagaaggtgatgtaggattgaaggtag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
158092 gatattcaaaagaaggtgggatttacttttactatggaagatgtaagtactacgacaaaattggtagagttggaagaaggtgatgtaggattgaaggtag 158191  T
101 caagggagagactaaattgcaatcaatgattattacaaccttcaatgttagaaggttgggaggaagaaataaaaggaataaaatcaaggagttggtgagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
158192 caagggagagactaaattgcaatcaatgattattacaaccttcaatgttagaaggttgggaggaagaaataaaaggaataaaatcaaggagttggtgagt 158291  T
201 aataataaagtggannnnnnnggctttccnnnnnnnnnnnnttgagttaataacagggtccttatgtcactctttgtagggtggagttgattgtgattgg 300  Q
    ||||||||||||||       ||||||||            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
158292 aataataaagtggatttttttggctttccaaaaaataaaaattgagttaataacagggtccttatgtcactctttgtagggtggagttgattgtgattgg 158391  T
301 gtgtttctacct 312  Q
    ||||||||||||    
158392 gtgtttctacct 158403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University