View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_high_23 (Length: 307)
Name: NF14343_high_23
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 13 - 289
Target Start/End: Original strand, 20719287 - 20719568
Alignment:
| Q |
13 |
gataattctagggttttggttttgcttcctttcttcttgctctctcaaggaggagcaatggatttgtccaaagttggtgaaaagattttcagttctgtta |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20719287 |
gatagttctagggttttggttttgcttcctttcttcttgctctctcaaggaggagcaatggatttgtccaaagttggtgaaaagattttcagttctgtta |
20719386 |
T |
 |
| Q |
113 |
agtctgctagatcgcttggtttacttccttctcttcctgatcgccccgaggtaattcaattaatcctgtagcaccgacaat-----tcgaaggtgtgtct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20719387 |
agtctgctagatcgcttggtttacttccttctcttcctgatcgccccgaggtaattcaattaatcctgtagcaccgacaattctgatcgaaggtgtgtct |
20719486 |
T |
 |
| Q |
208 |
gacacgtgtcggtccgtgtctaacaccgacccatgtgattacattcaatttattattttctcgatttactactggtgtcaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20719487 |
gacacgtgtcggtccgtgtctaacactgacacatgtaattacattcaatttattattttctcgatttactactggtgtcaac |
20719568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 257
Target Start/End: Complemental strand, 24674343 - 24674310
Alignment:
| Q |
224 |
tgtctaacaccgacccatgtgattacattcaatt |
257 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
24674343 |
tgtctaacaccgacacatgtgattacattcaatt |
24674310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University