View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14343_high_24 (Length: 307)

Name: NF14343_high_24
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14343_high_24
NF14343_high_24
[»] chr6 (2 HSPs)
chr6 (230-301)||(31304612-31304683)
chr6 (23-58)||(31304868-31304903)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 230 - 301
Target Start/End: Complemental strand, 31304683 - 31304612
Alignment:
230 gagaagagaaaataaattttaagtttgcaaaaagacaacctgcgagcgaatgagcgaagatcatgatgatgt 301  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31304683 gagaagagaaaataaattttaagtttgcaaaaagacaacctgcgagcgaatgagcgaagatcatgatgatgt 31304612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 58
Target Start/End: Complemental strand, 31304903 - 31304868
Alignment:
23 aagtgctgctgttgcggaattaacggcgtcgccatc 58  Q
    ||||||||||||||||||||||||||||||||||||    
31304903 aagtgctgctgttgcggaattaacggcgtcgccatc 31304868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University