View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_high_36 (Length: 228)
Name: NF14343_high_36
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 32391760 - 32391568
Alignment:
| Q |
19 |
tctgaacaggcgagaggaatggtatttattctgtttgttccgggtataattatacgatgaggtttatggagttgacaaggtccatgttgagggaaattgg |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32391760 |
tctggacaggcgagaggaatggtatttattcggtttgttccgggtataattatatgatgaggtttatggagttgacaaggtccatgttgagggaaattgg |
32391661 |
T |
 |
| Q |
119 |
gatagcatgtggtgtgcaagacaccaaaagttcgtgatctagcttgatgtcacggatgtcaaccagctcgctcaaatctgacagcacgtcatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32391660 |
gatagcatgtggtgtgcaagacaccaaaagttcgtgatctagcttgatgtcacggttgtcaaccaactcgctcaaatctgacagcacgtcatg |
32391568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 26161078 - 26160891
Alignment:
| Q |
30 |
gagaggaatggtatttattctgtttgttccgggtataattatacgatgaggtttatggagttgacaaggtccatgttgagggaaattgggatagcatgtg |
129 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||| ||||| ||||||||||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
26161078 |
gagaggaatggtatttatttggtttgatccgggtgtaattatatgatgaagtttatggagtcgacaagttccatgttgagggagattgggatagcatgtg |
26160979 |
T |
 |
| Q |
130 |
gtgtgcaagacaccaaaagttcgtgatctagcttga------tgtcacggatgtcaaccagctcgctcaaatctgacagcacgtcatg |
211 |
Q |
| |
|
|||||| |||||||||| |||||| ||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
26160978 |
gtgtgcgagacaccaaaggttcgtaatctagcttgaaggacttgtcacggatgtcaaccaactcgctcaaatctgactgcacgtcatg |
26160891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University