View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_high_37 (Length: 221)
Name: NF14343_high_37
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 53273958 - 53274162
Alignment:
| Q |
1 |
attaaatactactatgaaaaaacagacaaaatagttcgtgcagtcagaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaaattaagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53273958 |
attaaatactactatgaaaaaacagacaaaatagttcgtgcagtcagaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaaattcagct |
53274057 |
T |
 |
| Q |
101 |
gaaaagaaaagggagggaagaaagagtgagcatttgc---aagtagctaaacttattcttcaatgtgtaccttgatgatttgtttcttcatattattggg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
53274058 |
-----gaaaagggagggaagaaagagtgagcatttgcaagaagtagctagacttattcttcaatgtgtaccttaatgatttatttcttcatattattggg |
53274152 |
T |
 |
| Q |
198 |
agttgtttct |
207 |
Q |
| |
|
|||||||||| |
|
|
| T |
53274153 |
agttgtttct |
53274162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University