View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_low_18 (Length: 353)
Name: NF14343_low_18
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 226 - 338
Target Start/End: Complemental strand, 4349892 - 4349780
Alignment:
| Q |
226 |
aacacatgttgttatagcatatgaaagtaagatgacaaaaggtagtgctacttttaagagagaaaaaggaaataatagtgaactattttcaattattgaa |
325 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4349892 |
aacatatgttgttatagcatatgaaagtaagatgacaaaaggtagtgcgacttttaagagagaaaaaggaaataatagtgaactatttgcaattattgaa |
4349793 |
T |
 |
| Q |
326 |
ctccttagataat |
338 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4349792 |
ctccttagataat |
4349780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University