View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14343_low_18 (Length: 353)

Name: NF14343_low_18
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14343_low_18
NF14343_low_18
[»] chr4 (1 HSPs)
chr4 (226-338)||(4349780-4349892)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 226 - 338
Target Start/End: Complemental strand, 4349892 - 4349780
Alignment:
226 aacacatgttgttatagcatatgaaagtaagatgacaaaaggtagtgctacttttaagagagaaaaaggaaataatagtgaactattttcaattattgaa 325  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
4349892 aacatatgttgttatagcatatgaaagtaagatgacaaaaggtagtgcgacttttaagagagaaaaaggaaataatagtgaactatttgcaattattgaa 4349793  T
326 ctccttagataat 338  Q
    |||||||||||||    
4349792 ctccttagataat 4349780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University