View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_low_25 (Length: 307)
Name: NF14343_low_25
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 230 - 301
Target Start/End: Complemental strand, 31304683 - 31304612
Alignment:
| Q |
230 |
gagaagagaaaataaattttaagtttgcaaaaagacaacctgcgagcgaatgagcgaagatcatgatgatgt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31304683 |
gagaagagaaaataaattttaagtttgcaaaaagacaacctgcgagcgaatgagcgaagatcatgatgatgt |
31304612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 58
Target Start/End: Complemental strand, 31304903 - 31304868
Alignment:
| Q |
23 |
aagtgctgctgttgcggaattaacggcgtcgccatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31304903 |
aagtgctgctgttgcggaattaacggcgtcgccatc |
31304868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University