View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_low_41 (Length: 218)
Name: NF14343_low_41
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 13288871 - 13289004
Alignment:
| Q |
16 |
catactcaagctcaagcatgtctataccctttatattcactaatgtaagtttacataattgataaaagaagtaattattgtaacttttgaactttgaaac |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13288871 |
catactcaagctcaagcatatctataccctttatattcactaatgtaagtttacataattgataaaagaagtaattagtgtaacttttgaactttgaaac |
13288970 |
T |
 |
| Q |
116 |
tagggtccatttttagtagaatagttgattttgt |
149 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
13288971 |
tagggtccatttttagtagaacagttgattttgt |
13289004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University