View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14343_low_5 (Length: 525)
Name: NF14343_low_5
Description: NF14343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14343_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 25 - 294
Target Start/End: Complemental strand, 11354394 - 11354121
Alignment:
| Q |
25 |
gtgactagcaaaagaccatgatgctggagccaaactatgagcgacgcgattgacttgttttttagtaaaacttat-atatagttttgtttgttttaaagg |
123 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
11354394 |
gtgactagcaaaataccatgatgctggagccaaacaatgagcaacgcgattgacttgttttctagtaaaacctaccatagagttttgtttgttttaaagg |
11354295 |
T |
|
| Q |
124 |
attcctctgtgttttcttaaggtgtcaaaactcattaacataaacaatctccccataaatctcatgatataa---accctctaacaattagtattaattt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||| |||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
11354294 |
attcctctgtgttttcttaaggtgtccaaactcattatcataaaccatctccccataaattccatgatataataaaccctctgacaatcggtattaattt |
11354195 |
T |
|
| Q |
221 |
tcgcatcaacattgcatttggcatacattagttaattgcttccctgtgagaatgatttcgagcgcgcacatgaa |
294 |
Q |
| |
|
| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11354194 |
ttgcgtcagcattgcatttggcatacattagttaattgcttccctgtgagaatgatttcgagcgtgcacatgaa |
11354121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 396 - 511
Target Start/End: Complemental strand, 11354122 - 11354011
Alignment:
| Q |
396 |
aaaccatcaacatcacctctttttgccttgacagttatttttcagcaaactgaacaaacatgtaactgcagtgtgcacattgcacaaaacttattgccag |
495 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||| ||||||||||| ||||||| ||||| |||| |||||| ||| |||| ||| |||||||| |
|
|
| T |
11354122 |
aaaccatcaacgtcacttctttttcccttgacagttctttttcagcaagctgaacagacatgcaactacagtgtctaca----acaacactcattgccag |
11354027 |
T |
|
| Q |
496 |
atcaacttctgtattg |
511 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11354026 |
atcaacttctgtattg |
11354011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University