View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14344_low_6 (Length: 236)

Name: NF14344_low_6
Description: NF14344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14344_low_6
NF14344_low_6
[»] chr5 (1 HSPs)
chr5 (173-219)||(16498920-16498966)


Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 16498920 - 16498966
Alignment:
173 ctaacaattgatttctcataaaactcatacattgaaatggaagaaat 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
16498920 ctaacaattgatttctcataaaactcatacattgaaatggaagaaat 16498966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University